ID: 1090148601_1090148603

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1090148601 1090148603
Species Human (GRCh38) Human (GRCh38)
Location 11:124357238-124357260 11:124357275-124357297
Sequence CCTAATTTTACTTTACTTGATCA CATCTTTTCTAGAAGAAAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 64, 4: 638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!