ID: 1090161521_1090161526

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090161521 1090161526
Species Human (GRCh38) Human (GRCh38)
Location 11:124500249-124500271 11:124500290-124500312
Sequence CCTCCACTAGATTTGCCTGAAAT TTAATTTGAATCTTCATCTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!