ID: 1090178770_1090178773

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090178770 1090178773
Species Human (GRCh38) Human (GRCh38)
Location 11:124674684-124674706 11:124674708-124674730
Sequence CCTCCCTCACACACACGCACGCA AACCCCATTCCACAGTACGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 57, 3: 784, 4: 8468} {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!