ID: 1090186252_1090186256

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1090186252 1090186256
Species Human (GRCh38) Human (GRCh38)
Location 11:124740713-124740735 11:124740749-124740771
Sequence CCCTGCTGGCGAGGAAAGGAAGT CAGCGCCCACGCGGAAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155} {0: 1, 1: 0, 2: 1, 3: 1, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!