ID: 1090188322_1090188332

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1090188322 1090188332
Species Human (GRCh38) Human (GRCh38)
Location 11:124752218-124752240 11:124752254-124752276
Sequence CCCAAGGGCAGCCGCCCGGGCTG CTGGTATCTCAGAGCAAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 200} {0: 1, 1: 0, 2: 2, 3: 20, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!