ID: 1090190022_1090190041

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1090190022 1090190041
Species Human (GRCh38) Human (GRCh38)
Location 11:124761403-124761425 11:124761440-124761462
Sequence CCAATTTCCCCTCTTCCCTTTGG AAGGGTGGTGGGCCTTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 522} {0: 1, 1: 0, 2: 5, 3: 39, 4: 517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!