ID: 1090205183_1090205194

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1090205183 1090205194
Species Human (GRCh38) Human (GRCh38)
Location 11:124879926-124879948 11:124879953-124879975
Sequence CCAGCGGGTGCTCCACCCAGATG GCAGGGCCAGGGCAGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98} {0: 1, 1: 3, 2: 19, 3: 203, 4: 1555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!