ID: 1090205183_1090205197

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090205183 1090205197
Species Human (GRCh38) Human (GRCh38)
Location 11:124879926-124879948 11:124879967-124879989
Sequence CCAGCGGGTGCTCCACCCAGATG GGCAGGAGGGCTGCTGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98} {0: 1, 1: 0, 2: 3, 3: 37, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!