ID: 1090226373_1090226379

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1090226373 1090226379
Species Human (GRCh38) Human (GRCh38)
Location 11:125074521-125074543 11:125074553-125074575
Sequence CCAGGCAAAAGGGCCATGGAGCA GAACACCTGGGGCCACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 315} {0: 1, 1: 0, 2: 3, 3: 18, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!