ID: 1090232032_1090232041

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1090232032 1090232041
Species Human (GRCh38) Human (GRCh38)
Location 11:125114285-125114307 11:125114325-125114347
Sequence CCCCCAAATCTCAGGACCTCAGC CCCGGCCCAGTATGATGAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 24, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!