ID: 1090259965_1090259971

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1090259965 1090259971
Species Human (GRCh38) Human (GRCh38)
Location 11:125312475-125312497 11:125312497-125312519
Sequence CCTGCTGTGCCCCAGGAGAGCAG GACAGGCTGTGAGGTGAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 398} {0: 1, 1: 0, 2: 2, 3: 19, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!