ID: 1090262054_1090262059

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1090262054 1090262059
Species Human (GRCh38) Human (GRCh38)
Location 11:125328197-125328219 11:125328243-125328265
Sequence CCTGCTCTGGCCATTGTGGGATC CATCACACACACATTGTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 215} {0: 1, 1: 0, 2: 0, 3: 18, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!