ID: 1090263450_1090263452

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1090263450 1090263452
Species Human (GRCh38) Human (GRCh38)
Location 11:125339212-125339234 11:125339227-125339249
Sequence CCTGCCTCAGAGGATGTGGGTAA GTGGGTAATAACCCTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207} {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!