ID: 1090276310_1090276315

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1090276310 1090276315
Species Human (GRCh38) Human (GRCh38)
Location 11:125422233-125422255 11:125422278-125422300
Sequence CCCAGCCACGACTGTCTTCATTC GCCTGAAGGCCTTTAGTGTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 157} {0: 1, 1: 0, 2: 1, 3: 2, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!