ID: 1090279387_1090279391

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090279387 1090279391
Species Human (GRCh38) Human (GRCh38)
Location 11:125443029-125443051 11:125443053-125443075
Sequence CCCGGCCCTGTGGTGGAGTTTTC TACCAGAACTTGACCAGACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 255} {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!