ID: 1090299849_1090299851

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1090299849 1090299851
Species Human (GRCh38) Human (GRCh38)
Location 11:125626027-125626049 11:125626042-125626064
Sequence CCGGTAGAGTAGGGAAGGTTTCT AGGTTTCTAAAGAAGGAGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 112} {0: 1, 1: 0, 2: 5, 3: 26, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!