ID: 1090327912_1090327918

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1090327912 1090327918
Species Human (GRCh38) Human (GRCh38)
Location 11:125904666-125904688 11:125904691-125904713
Sequence CCCGCGAGCGTTCGAAGTGGGGC CAGATGCTGGAGGGGAGATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 16} {0: 1, 1: 1, 2: 5, 3: 89, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!