ID: 1090329181_1090329185

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1090329181 1090329185
Species Human (GRCh38) Human (GRCh38)
Location 11:125916905-125916927 11:125916952-125916974
Sequence CCTCACGTGGAACAGGGGTGCGT AAGTGCTTGAAGAAGAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31} {0: 1, 1: 0, 2: 4, 3: 40, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!