ID: 1090334193_1090334202

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1090334193 1090334202
Species Human (GRCh38) Human (GRCh38)
Location 11:125951768-125951790 11:125951803-125951825
Sequence CCTTCCTCCTTCCACAGGGCCAT TTCCTTCCAGGGGAGCCTCTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!