ID: 1090334196_1090334208

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1090334196 1090334208
Species Human (GRCh38) Human (GRCh38)
Location 11:125951779-125951801 11:125951819-125951841
Sequence CCACAGGGCCATACTGAGCCATC CTCTCGGGAGGCCTACCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!