ID: 1090344808_1090344815

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1090344808 1090344815
Species Human (GRCh38) Human (GRCh38)
Location 11:126061822-126061844 11:126061868-126061890
Sequence CCTGATGAGGAAGGGCAGGCATT GCCTTCCACCTGATTTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 183} {0: 1, 1: 0, 2: 0, 3: 16, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!