ID: 1090367014_1090367017

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1090367014 1090367017
Species Human (GRCh38) Human (GRCh38)
Location 11:126215076-126215098 11:126215091-126215113
Sequence CCTGGAAAGTACAGTCATTGGGA CATTGGGAGCCAGGAGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 127} {0: 1, 1: 0, 2: 1, 3: 49, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!