ID: 1090371220_1090371225

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1090371220 1090371225
Species Human (GRCh38) Human (GRCh38)
Location 11:126254472-126254494 11:126254519-126254541
Sequence CCTGGGAAATCTCTCTAAATATG TTCTTTTCATTAAGTGAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 165} {0: 1, 1: 0, 2: 8, 3: 158, 4: 1146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!