ID: 1090382002_1090382011

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090382002 1090382011
Species Human (GRCh38) Human (GRCh38)
Location 11:126333948-126333970 11:126333989-126334011
Sequence CCTAAACGGTTTTAAGCATGTGG CAGAATTAATTGGTGGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 61} {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!