ID: 1090389951_1090389956

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1090389951 1090389956
Species Human (GRCh38) Human (GRCh38)
Location 11:126382096-126382118 11:126382128-126382150
Sequence CCTGCAGCTGTCCAAATAGAGCA TGTTCTCTTTGGGGCACAGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 182} {0: 2, 1: 0, 2: 2, 3: 19, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!