ID: 1090394299_1090394308

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1090394299 1090394308
Species Human (GRCh38) Human (GRCh38)
Location 11:126408588-126408610 11:126408637-126408659
Sequence CCTAAAGAGGCTGTGAGGGGACA CGCCTTAGGCTGCCCTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200} {0: 1, 1: 0, 2: 0, 3: 1, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!