ID: 1090395646_1090395655

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1090395646 1090395655
Species Human (GRCh38) Human (GRCh38)
Location 11:126416394-126416416 11:126416436-126416458
Sequence CCAGCCTCTGTCGCCTTTTTCTG TTTCTCTGCAACAAAAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 366} {0: 1, 1: 0, 2: 4, 3: 22, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!