ID: 1090396661_1090396675

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090396661 1090396675
Species Human (GRCh38) Human (GRCh38)
Location 11:126423865-126423887 11:126423889-126423911
Sequence CCCTCCTCCCTCCCTCCCCCCAG ACACCAGGCTCTGACCGGACCGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 152, 3: 2625, 4: 17070} {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!