|
Left Crispr |
Right Crispr |
| Crispr ID |
1090401075 |
1090401078 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:126448666-126448688
|
11:126448686-126448708
|
| Sequence |
CCATGGGATGCCACAGCAAGAAG |
AAGGCAGCTGCCTGCAAGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 72, 2: 233, 3: 1047, 4: 2337} |
{0: 6, 1: 77, 2: 176, 3: 479, 4: 1588} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|