ID: 1090402571_1090402588

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1090402571 1090402588
Species Human (GRCh38) Human (GRCh38)
Location 11:126458493-126458515 11:126458546-126458568
Sequence CCCTCTTCCTGCTGGTGCCCAAG ACGGGAGCTGGCCTGAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 325} {0: 1, 1: 0, 2: 1, 3: 20, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!