ID: 1090428742_1090428746

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1090428742 1090428746
Species Human (GRCh38) Human (GRCh38)
Location 11:126628733-126628755 11:126628758-126628780
Sequence CCATCTTTCCTATTCATCAGATT CTGGAGCCCAGCCTGCTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 384} {0: 1, 1: 0, 2: 3, 3: 26, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!