ID: 1090430214_1090430218

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1090430214 1090430218
Species Human (GRCh38) Human (GRCh38)
Location 11:126639705-126639727 11:126639718-126639740
Sequence CCCATCAATCACCCACTTTCCAA CACTTTCCAACTCATCTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 196} {0: 1, 1: 0, 2: 2, 3: 24, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!