ID: 1090434231_1090434234

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1090434231 1090434234
Species Human (GRCh38) Human (GRCh38)
Location 11:126673558-126673580 11:126673580-126673602
Sequence CCAAAATTCATCTGTGTTTTCAC CTCACCACCACAGTCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 431} {0: 1, 1: 0, 2: 2, 3: 26, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!