ID: 1090434562_1090434566

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1090434562 1090434566
Species Human (GRCh38) Human (GRCh38)
Location 11:126676077-126676099 11:126676091-126676113
Sequence CCAGTTTGGGACATACTGAATTT ACTGAATTTCAGATGGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 206} {0: 1, 1: 0, 2: 2, 3: 34, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!