ID: 1090450311_1090450317

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1090450311 1090450317
Species Human (GRCh38) Human (GRCh38)
Location 11:126800394-126800416 11:126800424-126800446
Sequence CCCGGGTCAGAGGAGCTTGAAGA CTACAGAAACGGTCTCATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 227} {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!