ID: 1090456059_1090456065

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1090456059 1090456065
Species Human (GRCh38) Human (GRCh38)
Location 11:126850652-126850674 11:126850702-126850724
Sequence CCAACAGAGGAAGACTTTACCAG CTGCTTATCCCCAAAATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 148} {0: 1, 1: 0, 2: 2, 3: 18, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!