ID: 1090457767_1090457770

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1090457767 1090457770
Species Human (GRCh38) Human (GRCh38)
Location 11:126864767-126864789 11:126864780-126864802
Sequence CCTTGAGTGCATGCCTCTAAAGC CCTCTAAAGCTGATGGAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100} {0: 1, 1: 1, 2: 3, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!