ID: 1090458467_1090458475

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1090458467 1090458475
Species Human (GRCh38) Human (GRCh38)
Location 11:126869393-126869415 11:126869434-126869456
Sequence CCACTCTCCTGCAGTGTCTCCAG GTTACTGGCACTGGAATTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 467} {0: 1, 1: 0, 2: 1, 3: 26, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!