ID: 1090462287_1090462291

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090462287 1090462291
Species Human (GRCh38) Human (GRCh38)
Location 11:126902202-126902224 11:126902226-126902248
Sequence CCAAAAGGTGCTGTCATTGATGC GGCAAGGAAATACCCACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97} {0: 1, 1: 0, 2: 0, 3: 28, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!