ID: 1090465960_1090465965

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1090465960 1090465965
Species Human (GRCh38) Human (GRCh38)
Location 11:126933387-126933409 11:126933403-126933425
Sequence CCTTCCTCCTTCAAGTCATCACG CATCACGTTATCTGCCTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176} {0: 1, 1: 0, 2: 1, 3: 4, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!