ID: 1090472576_1090472579

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1090472576 1090472579
Species Human (GRCh38) Human (GRCh38)
Location 11:126993343-126993365 11:126993381-126993403
Sequence CCCATGGCTTCTGAACATATCGC TTGTATTTGCATACACTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57} {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!