ID: 1090473057_1090473062

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1090473057 1090473062
Species Human (GRCh38) Human (GRCh38)
Location 11:126997023-126997045 11:126997043-126997065
Sequence CCTGTCTCCGAGGTGGAGATCAG CAGAGATCTCCCTGGAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101} {0: 1, 1: 0, 2: 3, 3: 37, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!