ID: 1090480025_1090480034

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1090480025 1090480034
Species Human (GRCh38) Human (GRCh38)
Location 11:127059845-127059867 11:127059869-127059891
Sequence CCAGTCCCATGACTCAGCTAGGG CAGAGGAAGGAGCAGGGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 143, 4: 1115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!