ID: 1090486359_1090486369 |
View in Genome Browser |
Spacer: -6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1090486359 | 1090486369 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 11:127115981-127116003 | 11:127115998-127116020 |
Sequence | CCCTCCGCAACCCTAAGGCGGGA | GCGGGAGGCCGAGGGCAGCGGGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |