ID: 1090486370_1090486372

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1090486370 1090486372
Species Human (GRCh38) Human (GRCh38)
Location 11:127116006-127116028 11:127116035-127116057
Sequence CCGAGGGCAGCGGGGAGTCGCGC TTCGCCCCTCATTTGACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!