ID: 1090521352_1090521356

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1090521352 1090521356
Species Human (GRCh38) Human (GRCh38)
Location 11:127482957-127482979 11:127482995-127483017
Sequence CCTGTTCAATTAAATCAAGAGGT TTCTGCAGGCTATACAAGGATGG
Strand - +
Off-target summary No data {0: 2, 1: 37, 2: 383, 3: 498, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!