ID: 1090586941_1090586945 |
View in Genome Browser |
Spacer: 16 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1090586941 | 1090586945 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11:128223197-128223219 | 11:128223236-128223258 |
| Sequence | CCATCCATGTCCTGCAAAGGACA | TACGACTACATAGTATTCCCTGG |
| Strand | - | + |
| Off-target summary | {0: 9, 1: 29, 2: 37, 3: 84, 4: 301} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||