ID: 1090587929_1090587931

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1090587929 1090587931
Species Human (GRCh38) Human (GRCh38)
Location 11:128234337-128234359 11:128234356-128234378
Sequence CCATTAGAATAGCTCCTGTATAG ATAGAATACATTGTACACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!