ID: 1090595701_1090595708

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1090595701 1090595708
Species Human (GRCh38) Human (GRCh38)
Location 11:128319013-128319035 11:128319066-128319088
Sequence CCCTTCAGGAAGTGGTATGCGAT CTGAGTCAGGGCTACCACAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!