ID: 1090619452_1090619464

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1090619452 1090619464
Species Human (GRCh38) Human (GRCh38)
Location 11:128548639-128548661 11:128548670-128548692
Sequence CCCGCTTGGGGCCCAGGCGCTGC GAAGGGCGAGGTTCGGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 314} {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!